iggyzig

i am sending positive energies in the direction of your monday

Proud of you for facing the Tube of Whirly Sounds with what I will assume is grace 💚

I posted a Strong Bad "THE SYSTEM IS DOWN" gif in my work chat in response to notice of a service outage and no one understood it and it served as a reminder of how utterly alien this particular facet of my existence truly is

CARBS 🤤

It could be Rosie from the song "Whole Lotta Rosie"

Or perhaps the ballbreaker from the song "Ballbreaker"

Following walkthroughs for Star Wars games is so difficult sometimes. I read "hit R2 to aim your blaster" in the guide and I try to do it, but my blaster doesn't aim at all and the little droid is bleeping non-stop obscenities at me 😖

I filled my wiper fluid reservoir once (wiper fluid went everywhere)

Cant' stop meeeeeeeeTGCATGAGTCAGTCAGTCATGACGACGTACTGCATGACTGAGCTAGCGACTGACTGACTCTGATCGATCCTGTGACTGACTGATGCATCTGCATGACTGATCGATGCACGTAGTCATGCTGACTGACGTACGTACTGACGTAGTCATCTGACTGACGTACGTACCATCGTACTGACTGACGTACGTAATCGTACGACGTACTGATCATCTACTGACTGCATGATCGACTGACTGAGTCTACACTACTGCGTACGTACGTTGCAGACTACTGACACTTGTA

Cool, enjoy my busted-ass genome everybody

Hey bluesky post the start of your genetic sequence! Mine is CTGAGTCATGCATGCAGTCAGTCATGCAGTCAGTCAGCTAGCATGCATGCACTACGTACGTTCATCGTACGATCTGACGATCGATCATCGACTGATCGATGCGTACGTAGTCAGCATCACTGCTAGCCGGCTAGCATCGTAGCTACGATCGTACGATCGAGCATCGATCATCGATCGAGTCGACTGACGTACGTACGTACGTGATCGTACGTCACGTACGTATCGAGCTAGCTACGATC

yeah, once

I feel this way about HDMI cables, as well. Are you SURE they go on only one way? Cause it sure feels like I can crunch that sucker in there and it'll connect, albeit catastrophically

EVERYTHING is enhanced with the inclusion of a dolphin!

DOLPHINDOLPHINDOLPHIN

I miss this sort of hard-hitting gaming journalism

There is only one thing sexier than being thoughtful and considerate, and that is a big ol butt

📸 is life! Sleep is overrated anyway, haha

EUVD European Vulnerability Database

Please update WinRAR!

euvd.enisa.europa.eu/vulnerabilit...

Trump to deploy National Guard to D.C. and federalize city police The news comes on what the president is calling the "Liberation Day" of D.C.

I don't post much about politics on this site (God knows there's enough here already), but I need folks to know about the regime's hostile takeover of my city this morning: www.axios.com/local/washin...

sleepybutt!

Technically true, though debatable

I naturally float so my options for ocean life are somewhat limited :(

Being a land-based mammal is tough sometimes

Invuidually numbered? Aaaaaw yeah we're off to the baby races

Play-Doh Allegory of the Cave playset

YouTube video by igglepiggle Stone Cold Steve Meowstin

Okay so zero dogs in this, sucks I know, but I didn't want to compromise the full artistic integrity of this idea (carty said "what if the Stone Cold theme had meows" as were driving to see WrestleMania and the idea persisted)

www.youtube.com/watch?v=iO3K...

YouTube video by igglepiggle Take Meow to the Ball Game (Mario Paint Composer PC)

Proof of dogs in other compositions: www.youtube.com/watch?v=HCSG... (someone in the comments is like "hey there's too many cats in this" - MY DUDE, DID YOU NOT STICK AROUND FOR THE DOGS)

Twitch Twitch is the world

Went into the last ten minutes of 8/08 to get this little ditty made, and I didn't even forget the final, most important piece

www.twitch.tv/videos/25352...

This. Is. Legit. AMAZING

Like, I understand that you can't tell me who the client is and everything... but it's CERN, isn't it