@rna-guy.bsky.social
Physician scientist at UW rheumatology. I study the genome to search for the causes of autoimmune diseases. Creator of a podcast (Bitesize Immunology). My research focuses on alternative splicing and non-coding RNA 🇮🇶🇺🇸
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.
We're at 735 registrants and counting! 🎉🦠
If you haven't registered yet, don't miss out on this exciting (free) symposium on gut microbial metabolites and their impacts on host health.
Please share with your networks. 🔗👇
isbscience.org/events/2025-...
Sorry. I can’t provide medical advice here. I recommend talking to your doctors
I don’t think so. This appears to be unique to dermatomyositis
Maybe we should have done this in the early days of Covid
3/n
They are so prevalent in our genomes (>1 million copies) and because of their sequence similarity, they anneal to each other creating dsRNA capable of triggering innate sensors leading to interferon production. My work showed a big increase in expression of these Alus in dermatomyositis muscles
2/n
But you know what looks like a virus: Alus! a type of non-coding RNA that has been copy-pasting itself in our genomes (they've done this so much that our genome is 10% Alus)
1/n
A dermatomyositis puzzle: it looks like a virus, but is not a virus, what is it?
A link with viruses has been explored for decades. This study looked for viral transcripts in RNAseq data of muscles from dermatomyositis patients, and found no viruses #rheumsky #immunosky #rnasky #medsky
Fascinating! This will be a fun story to tell at dinner parties
Biology is weird and complex
Happy international cat day! Did you know that your cat and all domestic cats, no matter where you are on Earth, are from the Middle East
www.science.org/doi/10.1126/...
Thank you
A new discovery in dermatomyositis: We found a big increase in expression of Alu elements in dermatomyositis muscle + a signature of increased dsRNA. Read more about our findings and the hypothesis we propose in a paper recently accepted by A&R
#RheumSky #ImmunoSky #RNAsky
Being a scientist is like being a standup comedian, you generate jokes (data) until you have enough material for a 1-hour event, then you tour the country to perform shows (grand rounds)
#academicsky
My quote of the day
If an elderly but distinguished scientist says that something is possible, he is almost certainly right; but if he says that it is impossible, he is very probably wrong.
Arthur C. Clarke
Reporting of the Xenon gas Mount Everest story makes it seem like anyone can just take Xenon and climb a mountain. These men were highly trained and spent 10 weeks sleeping in low oxygen tents, so they did acclimatize. It is unknown how much additional benefit Xenon provided (no control group)
First time at the #RNA25 conference. I’m delighted to overhear nearby groups say the word RNA so many times. The control frequency is zero
A great read, thank you
I study genomics in autoimmunity. As an outsider to the field, I appreciated your introduction discussing mediocre efficacy of drugs targeting plaques. Do you expect this indirect way of targeting plaques to have better efficacy? or do microglia have other effects that are independent from plaques?
Phrases in immunology that mean "we do not know":
- loss of tolerance
- crosstalk
- caused by genetic and environmental factors
#ImmunoSky #MedSky
New podcast episode on inflammation. topics covered:
- Inflammation is good for you
- Why and how do we develop fever? I question the idea that fever boosts immune processes or hurts pathogens.
- Low level non-infectious chronic inflammation
#ImmunoSky #MedSky
2/2
- What if new peptides not seen before by the immune system are made in lupus through dysregulated splicing? Can these become neoantigens driving autoimmune responses?
1/2
A new publication with a new idea in autoimmunity.
- The immune system learns to tolerate normally expressed peptides. This includes the multiple transcripts of the same genes that are made through alternative splicing.
#MedSky #ImmunoSky #RheumSky
Weekly recap in ACR Journals
Environmental Risk Factors for SLE through the Lens of Social Determinants of Health
doi.org/10.1002/acr....
Dysregulated mRNA splicing in SLE
doi.org/10.1002/acr2...
Associations of fire smoke and other pollutants with incident RA and RA-ILD
doi.org/10.1002/art....
I haven't done long exposure photography in years, decided to try it again on NYE. The space needle was electrified with fireworks and drones. Happy New Year #seattle
I’ll remember this the next time I order toci!
Interesting take. I appreciate highlighting the role of cytokines in infection pathology. I think what we currently call interferonopathy will still be different because the interferon abnormality is sufficient to cause disease.
I agree especially when there’s an outline slide then an objectives slide, it becomes redundant. I prefer to use a “what will you gain from this talk” slide
Love this advice. I’ve been doing the same since I watched this youtu.be/Unzc731iCUY?...
Pretty cool. Alus do all sorts of things!