James Cotton

Our lab has two funded PhDs to start in 2026 via the NorthWestBio programme

Project details here
www.gla.ac.uk/postgraduate...
...and here
www.gla.ac.uk/postgraduate...

Application deadline is Nov 21st 2025; apply here:
www.gla.ac.uk/postgraduate...

My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....

#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...

#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...

I'm also co-supervising a few other projects:
#1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics.
www.gla.ac.uk/postgraduate...

The link currently has the wrong text, but hopefully will be fixed soon. Please get in touch if you have questions, and apply by 21st November via the NorthWestBio system www.gla.ac.uk/postgraduate...

We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...

Univariate Regression Road
Non-Parametric Parade

If I ever build a housing estate, there will be no 'Oak Avenue'

Well done Lilly!

Well done Benedict!

We are recruiting!

Applications are open for Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track) grade 7/8/9.

To apply, visit www.jobs.gla.ac.uk/job/senior-l...

#worldchangerswelcome

Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow on FindAPhD.com PhD Project - Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow, listed on FindAPhD.com

PhD Opportunity

www.findaphd.com/phds/project...

Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.

Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?

not completely, but its good that you are so motivated to look less like me.

Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy.

We almost look like twins in our bsky profile pictures.. 😧

@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!

Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG
doi: 10.1074/jbc.M006091200.

tapeworm Hymenolepis diminuita:
SL1: CGGTCTTACCATAAAACTTGTATG
SL2: CCGGTCTTACCTTGCAATTTTTGTATG
SL3: AATCGGTCTTACTGTACTAACTTGTATG
doi: 10.1186/s12915-020-00899-w.

thats all I can think of just now.

No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.

The plant nematode Globodera pallida and G. rostochiensis have a bunch of different SLs (van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen (our paper doi.org/10.1186/gb-2... confirms this G. pallida, table S6)

The plant parasitic nematode Heterodera glycines has a bunch of alternative SLs too: (from doi.org/10.1038/s415...)

There are a bunch of other SL sequences in C. elegans that are used less commonly than SL1 and SL2 - the table here is from International Journal of Parasitology Vol. 26. No. IO, pp. 1025-1033. 1996

Genomic and transcriptomic variation defines the chromosome-scale assembly of Haemonchus contortus, a model gastrointestinal worm - Communications Biology Stephen Doyle et al. report the chromosome-scale genome assembly and transcriptome sequence data of Haemonchus contortus, a key parasitic nematode model. These data show nearly complete conservation o...

Hey Franck - the nematode Haemonchus contortus uses the same SL1 as C. elegans, but SL2 is different (GGTTTTAACCCAGTATCTCAAG). Both sequences show some variation (figure S8 of doi.org/10.1038/s420...).

no worries - if i come across a good synthesis of the complex nematode ones I'll let you know. There is also trans-splicing in other flatworms, but not sure what the sequences are. It must be known in some e.g. Echinococcus and Hymenolepis, and probably Fasciola too.

And this one in Schistosomes: AACCGTCACGGTTTTACTCTTGTGATTTGTTGCATG
I think PMID: 2247461 is the original reference

and some more in other nematodes: van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen: Wageningen University.

I suspect there are a bunch in nematodes, but i'm not sure if there is a good single list somewhere..

Spliced leader trans-splicing in the nematode Trichinella spiralis uses highly polymorphic, noncanonical spliced leaders The trans-splicing of short spliced leader (SL) RNAs onto the 5′ ends of mRNAs occurs in a diverse range of taxa. In nematodes, all species so far characterized utilize a characteristic, conserved spl...

Hi Franck. There are 15 SL sequences in Trichinella - table 2 of pmc.ncbi.nlm.nih.gov/articles/PMC...

We're looking for a post-doc to work on anthelminthic resistance in a new pan-European project. It will involve generating and analysing targeted and whole-genome data from well-phenotyped livestock GIN populations.

Please get in touch if you have any questions.

www.jobs.gla.ac.uk/job/research...

Cool. Its almost like social media is useful for something again!