@iselleggs.bsky.social
(SocDem, Eurofed) Lives in a village in BW (southern germany) he/him 18 https://x.com/Iselleggs?t=Me_4FWDv91N4Q0JuJaWEgw&s=09
Bro had a vision
28.11.2024 01:18 β π 0 π 0 π¬ 0 π 0
Twitter ain't real bro
27.11.2024 16:19 β π 1 π 0 π¬ 0 π 0What the fuck is the context bro
27.11.2024 15:13 β π 1 π 0 π¬ 1 π 0My puppet AI when i call them to join me against a country 700x their size:
27.11.2024 14:54 β π 11 π 5 π¬ 2 π 0
Only in americaππππ
27.11.2024 12:18 β π 0 π 0 π¬ 0 π 0American truck simulator is legit peak gaming
24.11.2024 20:09 β π 1 π 0 π¬ 0 π 0
Me when I use GDP per capita as a measure for wealth:
22.11.2024 23:50 β π 0 π 0 π¬ 0 π 0We returning eugenics with this one π£π£π£π₯π₯π₯
x.com/captgouda24/...
GrΓΌne on their way to not lose vote share despite being constantly slandered:
21.11.2024 19:37 β π 1 π 0 π¬ 0 π 0
Twitter
Ignore the π»
From xitter
20.11.2024 17:12 β π 0 π 0 π¬ 0 π 0Saw goth girls at uni info day today.
My life will never be the same.
20.11.2024 00:22 β π 0 π 0 π¬ 0 π 0
Just bring them to work
20.11.2024 00:19 β π 1 π 0 π¬ 1 π 0VOC might have been evil as shit but they had some banger songs
20.11.2024 00:19 β π 0 π 0 π¬ 0 π 0
So true! (From twitter)
20.11.2024 00:15 β π 1 π 0 π¬ 0 π 0I will try and post all my tweets here as well, plus anything i post here exclusively of course
20.11.2024 00:14 β π 0 π 0 π¬ 0 π 0Omg doggerrrrrr your here
20.11.2024 00:11 β π 1 π 0 π¬ 1 π 0Hello bitches I am back
20.11.2024 00:11 β π 1 π 0 π¬ 1 π 0Is this that bait poster from twitter
20.10.2024 22:24 β π 1 π 0 π¬ 1 π 0Can't goon without them
18.10.2024 20:23 β π 1 π 0 π¬ 0 π 0
Only we working together can bring Gunther Fehlinger to Bluesky. Together WE can do this!
18.10.2024 19:56 β π 6 π 1 π¬ 1 π 1Trans civil war
18.10.2024 18:11 β π 3 π 0 π¬ 1 π 0Well if he's only an ethnofascist π₯°π₯°π₯°πππ
18.10.2024 18:10 β π 2 π 0 π¬ 1 π 0When they say the name of the movie
18.10.2024 17:16 β π 1 π 0 π¬ 0 π 0Touche
18.10.2024 11:36 β π 0 π 0 π¬ 0 π 0What's your twitter tho
18.10.2024 01:24 β π 0 π 0 π¬ 1 π 0Dieser Begriff ist mir noch nie in die Quere gekommen, danke fΓΌr die Recommendation
18.10.2024 01:22 β π 0 π 0 π¬ 0 π 0ATCGTACGGTACGATTCGATCGGCTTAGCTCGGATCGATGCTAGCTCGGATTAGCCTAGCTCGTAGGCTAG
I doxxed your genome structure
