Maura McGrail's Avatar

Maura McGrail

@mcgraillab.bsky.social

Zebrafish developmental geneticist, genome engineer, brain development and disease

170 Followers  |  264 Following  |  11 Posts  |  Joined: 29.03.2025  |  1.7088

Latest posts by mcgraillab.bsky.social on Bluesky

🙂 will do. Thanks!

03.05.2025 01:01 — 👍 1    🔁 0    💬 0    📌 0

Still looking

01.05.2025 21:06 — 👍 0    🔁 0    💬 0    📌 0

Ok, thanks!

01.05.2025 21:06 — 👍 0    🔁 0    💬 0    📌 0

#zebrafish Does anyone stateside have a ubi:mRFP-CAAX line? Thanks!

30.04.2025 13:51 — 👍 2    🔁 2    💬 2    📌 2

“We report a novel imaging technique using a recently developed clearing reagent called LUCID that makes it possible to capture the complete cellular-resolution 3D structures of larval and juvenile zebrafish.”

New work from Weinstein Lab at NIH 🐟

08.04.2025 18:21 — 👍 59    🔁 17    💬 0    📌 0

thanks - will add that info to the site!

10.04.2025 13:31 — 👍 1    🔁 0    💬 0    📌 0

shield stage

10.04.2025 13:16 — 👍 1    🔁 0    💬 1    📌 0

KI is at the 3' end of the coding sequence - should report on all transcripts.

10.04.2025 12:41 — 👍 2    🔁 0    💬 1    📌 0
Preview
runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...

#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...

Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!

09.04.2025 20:45 — 👍 12    🔁 1    💬 1    📌 1
Post image

So long, NIH. The place I grew up in and discovered my passion for science communication.

I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.

I'm so devastated that my whole team got laid off today.

01.04.2025 23:01 — 👍 460    🔁 98    💬 12    📌 6
Preview
Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...

#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org

Check out what's available, imaging and information, and make a request.

We're so very grateful to the NIH ORIP for supporting this work!

Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!

01.04.2025 17:52 — 👍 17    🔁 5    💬 0    📌 3
Post image

Zebrafish Community Cre/lox Resource website (ZebrafishCCR) will be online soon!

29.03.2025 18:21 — 👍 29    🔁 9    💬 0    📌 3
Lineage labeling with zebrafish hand2 Cre and CreERT2 recombinase CRISPR knock‐ins You have to enable JavaScript in your browser's settings in order to use the eReader.

Our DyDy zebrafish hand2-cre and hand2-creERT2 KI paper is online!
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...

Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.

Ready to ship - email requests to mmcgrail@iastate.edu

29.03.2025 18:13 — 👍 11    🔁 2    💬 0    📌 2

@mcgraillab is following 20 prominent accounts